Generation of Net39 KO mice

All animal procedures were approved by the Institutional Animal Care and Use Committee at the University of Texas Southwestern Medical Center.

CRISPR Cas9 guides flanking exon 1 of the Net39 (also referred to as Plpp7) gene were selected from CRISPR 10K Genome Browser Track, cloned into pX458 (Addgene # 251928), transfected into N2a cells, FACS sorted, and cutting efficiency was assessed by T7E1 assay as per the provider’s instructions (New England BioLabs #E3321).

#1Net39-sgRNA-5’5’-TCCCTGAACCAGCCCCCCAA-3’

#2Net39-sgRNA-3’5’-GGGTTGGGCCGGCTCCCAGA-3’

Cas9 mRNA and Net39 sgRNAs (#1 and #2) were injected into the pronucleus and cytoplasm of zygotes. For zygote production, B6C3F1 female mice were treated for superovulation and mated to B6C3F1 stud males. Zygotes were isolated, transferred to M16 and M2 medium, injected with Cas9 mRNA and sgRNA, and cultured in M16 medium for 1 h at 37 °C. Injected zygotes were transferred into the oviducts of pseudo-pregnant ICR female mice.

Tail genomic DNA was extracted from F0 mice and used for genomic analysis with PCR primers that amplify the targeted region. Primers 1 and 2 amplify fragments of different size in WT and KO mice. Primers 2 and 3 only amplify the WT allele.

#1Net39-WT/KO-F5’-GCAGCTGGAGGTAAATAGCC-3’

#2Net39-WT/KO-R5’-CTCCCCACACTAGAGGCTTG-3’

#3Net39-WT.only-F5’-GCAGATGTCAATAGCCAGCA-3’

Mosaic mice were mated to C57BL6N mice and a mouse line with a 559-bp deletion was selected for further characterization. Experiments requiring mice were sex balanced (2 males, 1 female per genotype).

Radioisotopic in situ hybridization (ISH)

Radioisotopic ISH was performed on E12.5 embryo sections and modified from prior protocols⁴⁴. For pre-hybridization, embryo section slides were heated to 58 °C for 30 min, deparaffinized in xylene, and hydrated by sequential ethanol/diethyl pyrocarbonate (DEPC)-saline washes (95, 85, 60, 30%) to DEPC-saline. Microwave RNA retrieval was performed in plastic containers (Miles Tissue-Tek, Elkhart, IN) filled with DEPC-1× Antigen Retrieval Citra pH 6.0 (Biogenex, San Ramon, CA), and samples were heated in a 750-watt microwave at 90% power for 5 min. Evaporated solution was replaced with DEPC-H₂O, and an additional heating was performed at 60% power for 5 min. Samples were cooled down for 20 min and washed twice in DEPC-phosphate-buffered saline (PBS) for 5 min. Samples were then permeabilized for 7.5 min with 20 μg/ml pronase-E in 50 mM Tris-HCl, pH 8.0, 5 mM EDTA, pH 8.0 in DEPC-H₂O. Samples were then washed in DEPC-PBS twice and re-fixed in 4% paraformaldehyde/DEPC-PBS, pH 7.4, for 5 min, washed in DEPC-PBS, and acetylated in 0.25% acetic anhydride/0.1 M triethanolamine–HCl, pH 7.5, twice for 5 min. Slides were then equilibrated in 1× SSC, pH 7.0, for 5 min, incubated in 50 mM n-ethylmaleimide/1× SSC, pH 7.0, for 20 min, and washed in DEPC-PBS, pH 7.4, and DEPC-saline. Finally, slides were dehydrated through graded ethanol/DEPC-saline rinses (30, 60, 85, 95%) to absolute ethanol and dried under vacuum for 2 h.

Net39 mRNA probe sequence was synthesized by Integrated DNA Technologies (IDT) and cloned into pCRII-Topo vector (ThermoFisher, K460001) as per the provider’s instructions. MAXIscript SP6/T7 (Life Technologies, AM1320) was used for in vitro transcription of the probe. The following sequence was used as probe:

CCTGCTGGCTATTGACATCTGCATGTCCAAGCGACTGGGGGTGTGTGCCGGCCGGGCTGCATCCTGGGCCAGCGCCCGCTCCATGGTCAAGCTCATTGGCATCACAGGCCACGGCATTCCTTGGATCGGGGGCACCATCCTCTGCCTGGTGAGAAGCAGCACCCTGGCTGGCCAAGAGGTGCTCATGAACCTGCTGCTAGCCCTGCTCTTGGACATCATGACAGTGGCTGGAGTCCAGAAGCTCATCAAGCGCCGCGGCCCATATGAGACCAGCCCTGGGCTCCTGGACTACCTCACCATGGACATCTATGCCTTCCCTGCCGGCCACGCCAGCCGTGCCGCCATGGTGT

The probe was diluted in hybridization mixture (50% formamide, 0.75 M NaCl, 20 mM Tris-HCl, pH 8.0, 5 mM EDTA, pH 8.0, 10 mM NaPO₄, pH 8.0, 10% dextran sulfate, 1× Denhardt’s, and 0.5 mg/ml tRNA) to achieve 7.5 × 10³ cpm/μl and heated to 95 °C for 5 min. Diluted probe was cooled to 37 °C and dithiothreitol (DTT) was added to a final concentration of 10 mM. The probe was applied over the sections in a Nalgene Nalgene utility box lined with 5× SSC/50% formamide-saturated gel blot paper. Hybridization was performed for 14 h at 70 °C.

After hybridization, slides were washed as follows: 5× SSC/10 mM DTT at 55 °C for 40 min, HS (2× SSC/50% formamide/100 mM DTT) at 65 °C for 40 min, three 10-min washes in NTE (0.5 M NaCl/10 mM Tris-HCl, pH 8.0/5 mM EDTA, pH 8.0) at 37 °C, NTE with RNase-A (2 μg/ml) at 37 °C for 30 min, NTE at 37 °C for 15 min, HS at 65° for 30 min, 2 washes in 2× SSC and 0.1× SSC each at 37 °C for 15 min. Slides were then dehydrated in graded ethanol rinses (30, 60, 85, 95%) to absolute ethanol and dried under vacuum.

For autoradiographic exposure, dried slides were added pre-warmed (42 °C) diluted Ilford K.5 nuclear emulsion (Polysciences, Warrington, PA) and dried at room temperature at 75% humidity for 3 h. Slides were then sealed with desiccant and stored at 4 °C for 28 days. After that, samples were developed in D19 (Eastman Kodak, Rochester, NY) at 14 °C, and the latent image was fixed with Kodak Fixer. After rinsing, hematoxylin counter-staining was performed (Richard-Allen, Kalamazoo, MI), and samples were dehydrated and mounted. Net39 expression was observed with a Leitz Laborlux-S microscope stand equipped with Plan-EF optics, a standard bright-field condenser, and a Mears low-magnification dark-field condenser.

Ex vivo electrophysiology

EDL and soleus muscles were isolated from postnatal day 17 (P17) mice and mounted on Grass FT03.C force transducers connected to a Powerlab 8/SP data acquisition unit (AD Instruments), under physiological salt solution at 37 °C, and continuous flux of 95% O₂–5% CO₂. Muscles were adjusted to initial length at which the passive force was 0.5 g and then stimulated with two platinum wire electrodes to establish optimal length for obtaining maximal isometric tetanic tension. Measurements were normalized to specific force (mN/mm²) to account for tissue cross-sectional area. For fatigue assays, after reaching optimal muscle length, muscles were stimulated for 20 s (fatigability measurements) or 10 min (for electron microscopy) at 0.8 Hz, 50 ms. Fatigue curves were calculated by comparing the relative change in force to the initial peak (considered 100%).

Histology, immunochemistry, and electron microscopy

Skeletal muscle tissues were flash-frozen in a cryoprotective 3:1 mixture of tissue-freezing medium (Triangle BioSciences International) and gum tragacanth (Sigma, G1128) and sectioned on a cryostat and routine hematoxylin and eosin staining was performed. For SDH staining, unfixed frozen sections were incubated in 0.2 M phosphate buffer (pH 7.6) containing sodium succinate and nitroblue tetrazolium chloride (NBT) for 60 min at 37 °C (21). For NADH staining, unfixed frozen sections were incubated in 0.05 M Tris buffer (pH 7.6) containing NADH and NBT for 30 min at 37 °C⁴⁵. Sections were cleared with acetone and mounted in aqueous medium. COX activity was detected in unfixed frozen sections by incubation for 1 h at room temperature in 1 mg/ml cytochrome C (Sigma, C2506)/6 mg/ml catalase (Sigma, C40)/0.5 mg/ml 3,3-diamonobenzidine tetrachloride (Sigma, D5637) in PBS, pH 7.4. Upon conclusion of incubation, sections were washed in distilled water, dehydrated, cleared, and coverslips mounted with synthetic mounting medium (ThermoFisher, SP15-100).

For immunofluorescence, cryosections were fixed in 4% paraformaldehyde for 15 min and permeabilized in 0.3% Triton X-100 for 15 min. Sections were blocked with mouse on mouse blocking solution (Vector Labs, BMK-2202) and 5% goat serum. Primary and conjugated Alexa Fluor secondary antibodies (ThermoFisher) were used at 1:200 dilution. The following antibodies and conjugated fluorophores were used: SUN2 (Sigma, MABT880), Lamin A (Abcam, ab26300), LEMD2 (Sigma, HPA017340), MYH7 (Santa Cruz, sc-53089), MYH2 (Santa Cruz, sc-53096), MYH4 (Proteintech, 20140-1-AP), PAX7 (DSHB, PAX7-c), SV2 (DSHB, SV2-c), Neurofilament (DSHB, 2H3-c), α-Bungarotoxin-555 (ThermoFisher, B35451), Phalloidin-488 (ThermoFisher, A12379), WGA-488 (ThermoFisher, W11261). Confocal images were obtained in Zeiss LSM 800. Myofiber diameter was measured with CellProfiler.

For electron microscopy of the whole muscle, mice were perfused with 4% paraformaldehyde and 1% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.4) and stained with 1% osmium tetroxide. For electron microscopy after ex vivo stretching, muscles were immediately fixed after 10 min of stimulation and contraction. Samples were processed by the University of Texas Southwestern Medical Center Electron Microscopy Core facility. Images were acquired using a FEI Tecnai G2 Spirit transmission electron microscope.

Plasmids and cloning

The ORF for Net39 was obtained in pCMV6-Entry backbone (Origene, MR203615). Net39 ORF was subcloned into the following custom-made pMXs-puro (Cell Biolabs, RTV-012) backbones: pMXs-puro-3xFLAG-HA (C-terminal) and pMXs-puro-miniTurbo (C-terminal). pMXs-puro-miniTurbo was generated by conventional cloning using pcDNA-V5-miniTurbo-NES (Addgene, #107170) as the PCR template.

Cell culture, overexpression, and immunofluorescence

C2C12 mouse myoblasts, N2a neuroblastoma cells, HEK 293T cells, and Platinum E cells (Cell Biolabs, NC0066908) were cultured in 10% fetal bovine serum with 1% penicillin/streptomycin in Dulbecco’s Modified Eagle Medium (DMEM). Cells were transfected with FuGENE6 (Promega, #E2692) as per the provider’s instructions. Ten micrograms of plasmid was used for 10-cm plate transfection and 20 µg of DNA was used for 15-cm plate transfection. Platinum E cells were used for retroviral virus production. Forty-eight hours after transfection, supernatants were collected and filtered through a 0.45-µm syringe filter. Virus was concentrated with Retro-X concentrator (Takara, 631456). After 16 h of viral concentration, viral soup was centrifuged at 1500 × g for 45 min, and the pellet was resuspended in fresh growth media supplemented with polybrene (Sigma, H9268) at a final concentration of 8 µg/ml. Twenty-four hours after infection, cells had their media replaced with fresh growth media.

For immunofluorescence, C2C12 cells overexpressing pMXs-puro-Net39-3xFLAG-HA or empty pMXs-puro-3XFLAG-HA were differentiated into myotubes for 5 days, fixed in 4% paraformaldehyde for 15 min, and permeabilized in 0.3% Triton X-100 for 15 min. Cells were blocked with 5% bovine serum albumin (BSA) in PBS for 1 h and incubated in primary and secondary antibodies in blocking solution for 1 h. The following antibodies were used at 1:200 dilution: mTOR (Cell Signaling, 2983) and My32 (Sigma, M4276).

Western blot analysis and co-IP

Protein was isolated from flash-frozen muscle samples by addition of RIPA buffer (Sigma, R0278) and mechanical homogenization in Precellys Evolution (3× 20 s at 6800 rpm). Protein concentration was determined by BCA assay (ThermoFisher, 23225), and equal amounts of protein among samples were used for regular western blot and transfer in polyvinylidene fluoride membrane (Millipore, IPVH00010).

For co-IP, stable cell lines of C2C12 myoblasts were generated by infection with retroviral pMXs-puro-Net39-3xFLAG-HA or empty pMXs-puro-3XFLAG-HA. For each condition five 15 cm plates were differentiated into myotubes for 5 days and processed for co-IP. Briefly, cells were washed with PBS and scraped on PBS. Cells were centrifuged at 500 × g for 5 min, and pellets were resuspended in 1.5 ml of 50 mM Tris, 150 mM NaCl, and 0.2% Triton, supplemented with protease inhibitor cocktail (Sigma, 11697498001) and PhosSTOP phosphatase inhibitor cocktail (Sigma, 4906845001). FLAG pulldown and elution were performed using Anti-FLAG M2 Magnetic Beads (Sigma, M8823) and 3xFLAG peptide (Sigma, F4799) as per the provider’s instructions. Beads were washed with 50 mM Tris, 350 mM NaCl, and 0.2% Triton before elution. In all, 2% of the lysate was loaded for input and the rest was used for co-IP.

Blocking and antibody incubation were performed in 5% milk in TBS-Tween 0.1%. The following antibodies were used at a 1:200 concentration (primary) or 1:5000 (horseradish peroxidase (HRP) conjugated): NET39 (Sigma, HPA070252), LEMD2 (Sigma, HPA017340), SUN2 (Sigma, MABT880), Lamin A (Abcam, ab26300), LMNB1 (Abcam, ab16048), EMD (Santa Cruz, sc-25284), VCL (Sigma, V9131), GAPDH (Sigma, MAB374), TUBB (Abcam, ab6046), Histone H3 (Cell Signaling, 9715 s), HRP-conjugated streptavidin (Thermofisher, N100), goat anti-Mouse IgG (H + L)-HRP Conjugate (Bio-Rad, 170-6516), and goat anti-Rabbit IgG (H + L)-HRP Conjugate (Bio-Rad, 170-6515). For mTOR signaling, western blot analysis was performed using 5% BSA for blocking and antibody incubation. The following antibodies were used at 1:200 concentration: AKT (Cell Signaling, 9272), RAPTOR (Cell Signaling, 2280), S6K (Cell Signaling, 9202), p-S6K (Thr389) (Cell Signaling, 9234), 4EBP1 (Cell Signaling, 9452), and p-4EBP1 (Ser65) (Cell Signaling, 9451). Immunodetection was performed using Western Blotting Luminol Reagent (Santa Cruz Biotechnology, sc2048).

Gene expression analysis

Flash-frozen quadriceps muscle samples from P9 and P17 mice were homogenized in 1 ml of Trizol in Precellys Evolution (3× 20 s at 6800 rpm). RNA was isolated using the RNeasy Micro Kit (Qiagen, 74004) as per the provider’s instructions. cDNA was synthesized using iScript Reverse Transcriptase (Bio-Rad).

RNA-seq (n = 3 mice per genotype) was performed by the UT Southwestern Genomic and Microarray Core Facility. Single-end raw reads with >30% nucleotide with phred quality scores <20 were filtered from further analysis. Quality-filtered reads were then aligned to the mouse reference genome (version GRCm38.mm10) using the HISAT2 aligner (v2.1.0). Aligned reads were then counted using featurecount (v 1.6.2) to assign read counts to each annotation gene id. DESeq2 R Bioconductor package^46,47 was used to normalize read counts and identify differentially expressed (DE) genes. Kyoto Encyclopedia of Genes and Genomes (KEGG)⁴⁸ pathway data were downloaded using KEGG API (https://www.kegg.jp/kegg/rest/keggapi.html) and gene ontology (GO) data were downloaded from NCBI FTP (ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/gene2go.gz). The enrichment of DE genes to pathways and GOs was calculated by Fisher’s exact test in R statistical package. DE genes were determined using cutoffs of fold changes >2 and an adjusted p value of <0.05.

Chromatin accessibility analysis

The ATAC-seq protocol was modified from prior published protocols⁴⁹. Flash-frozen quadriceps muscle samples from P17 mice (n = 3 mice per genotype) were resuspended in 1 ml of homogenization buffer (5 mM CaCl₂, 3 mM Mg acetate, 10 mM Tris pH 7.8, 320 mM sucrose, 200 µM EDTA, 0.1% NP-40, 0.05% BME, with cOmplete protease inhibitor cocktail (Sigma, 11697498001)) and disrupted with beads in Precellys Evolution (3× 20 s at 6800 rpm). Lysate was sequentially filtered through 70- and 40-µm cell strainers, laid on top of sucrose buffer (1 M sucrose, 3 mM Mg acetate, 10 mM Tris pH 7.8) and centrifuged at 1000 × g for 10 min. Nuclei in the pellet were permeabilized in 0.5 ml of 0.3% Triton in PBS for 30 min and washed twice with resuspension buffer (10 mM NaCl, 3 mM Mg acetate, 10 mM Tris pH 7.8). Transposition and library preparation were performed using TDE1 Tagment DNA Enzyme (Illumina, 15027865) and Nextera DNA Library Prep Kit (Illumina, 15027866) as per the manufacturer’s instructions⁴⁹. Sequencing (n = 3 mice per genotype) was performed by the UT Southwestern Genomic and Microarray Core Facility.

Paired-end raw reads were mapped to the mouse reference genome (GRCh38/mm10) using bowtie2 (version 2.3.4.3) with parameter “–very-sensitive” enabled. Read duplication and reads that mapped to chrM were removed from downstream analysis. Peaks were called using findpeaks command from the HOMER software package version 4.9, with parameter “–style dnase,” and the false discovery rate (FDR) threshold (for Poisson p value cutoff) was set to 0.001. Called peaks were merged from all samples and annotatePeaks.pl command was used to produce a raw count matrix. Differential peaks were identified using R package DEseq version 3.8. Differentially regulated peaks were determined using cutoffs of fold changes >2 and an adjusted p value of <0.05. To analyze the functional significance of peaks, Genomic Regions Enrichment of Annotations Tool was used with mm10 as the background genome and other parameters set as default.

Lamin A/C ChIP-seq

Frozen hindlimb muscles (n = 3 mice per genotype) were crushed to powder and crosslinked in 10 ml of PBS with 2% formaldehyde (Sigma, F8775) for 15 min at room temperature under rotation. Crosslinking was stopped with 1.5 ml of 2.5 M glycine. Samples were washed with PBS and incubated on ice for 10 min in Farham lysis buffer (5 mM PIPES, 85 mM KCl, 0.5% N-40, pH 8.0) before bead lysis in Precellys Evolution (3× 20 s at 6800 rpm). Lysates were then incubated on ice for 20 min, and the supernatant was removed after centrifugation (1000 × g, 5 min). The remaining pellet was resuspended in TE and 0.2% sodium dodecyl sulfate (SDS; 10 mM Tris-HCl pH 8.0, 1 mM EDTA), and nuclei were sonicated on Bioruptor pico (Diagenode) for 10 cycles (30 s on, 30 s off). In all, 1% of sheared DNA was saved for input, and the rest was diluted 1:1 with 1× TE 0.1% sodium deoxycholate and 1% Triton X-100 and 8 µg of Lamin A/C antibody was added (Santa Cruz, sc-7292 X) and conjugated to 60 µl of Protein G Dynabeads (ThermoFisher, 10003D). Lamin A/C immunoprecipitation was performed for 48 h at 4 °C, and beads were subsequently washed twice with RIPA buffer, 360 mM NaCl RIPA buffer, LiCl buffer (250 mM LiCl, 0.5% NP40, 0.5% deoxycholate, 1 mM EDTA, 10 mM Tris-HCl, pH 8.0), and TE buffer. DNA was released from the beads by addition of decrosslinking buffer (TE 0.3% SDS, 2 mg/ml proteinase K) and incubation at 65 °C for 16 h under constant mixing. RNA was then removed by incubation with 0.1 µg/µl of RNase A and incubation at 37 °C for 1 h under constant mixing. DNA was purified from the supernatant with the Qiagen PCR Purification Kit (Qiagen, 28104). Sequencing (n = 3 mice per genotype) was performed by the UT Southwestern Next Generation Sequencing Core.

Raw reads were mapped to the mouse reference genome (GRCh38/mm10) using bowtie2 (version 2.3.4.3) with default parameters. Duplicate reads were removed with “mark duplicates” from Picard tools (v.2.10.3). To detect LADs, Enriched Domain Detector (v.1.0) was used with a 10-Kb bin size, gap penalty of 10, and an FDR-adjusted significance threshold of 0.05. Gain, loss, and overlapping LADs between WT and KO samples were tallied using bedtools (v.2.29.0).

Metabolomics

Quadriceps from P17 WT and Net39 KO mice were harvested and flash-frozen in liquid nitrogen. Samples were homogenized in bead tubes with Precellys Evolution (3× 20 s at 6800 rpm) in 1 ml of methanol/water (80:20 vol/vol). In all, 200 µl of sample were transferred to a new tube with 800 µl of ice-cold methanol/water (80:20 vol/vol). Samples were vortexed for 1 min and centrifuged at 20,000 × g for 15 min at 4 °C. Supernatant was transferred to a new tube and dried with SpeedVac system. Samples were further processed and analyzed as described here and in prior protocols⁵⁰: samples were reconstituted in 0.03% formic acid, vortexed, and debris was removed by centrifugation. The supernatant was used for the metabolomic studies. Liquid chromatography with tandem mass spectrometry (LC-MS/MS) was performed with AB QTRAP 5500 liquid chromatography–triple quadrupole mass spectrometer (Applied Biosystems SCIEX). Two mobile phases were used for separation: 0.03% formic acid in water and 0.03% formic acid in acetonitrile (ACN). MultiQuant software v.2.1 (Applied Biosystems SCIEX) was used to review the chromatogram and integrate peak area. The peak area for each metabolite was normalized to the total ion count of that sample. Metabolite identification targeted for 458 metabolites and 445 metabolites were detected above the baseline set by cell-free samples. Statistical differences were determined via partial least squares-discriminant analysis.

Limma R Bioconductor package^46,51 was used to identify differentially regulated pathways. KEGG⁴⁸ compound and pathway data were downloaded using KEGG API (https://www.kegg.jp/kegg/rest/keggapi.html). Differentially enriched pathways were determined by Fisher’s exact test in R statistical package. Differentially regulated metabolites were determined using cutoffs of fold changes >2 and an adjusted p value of <0.05. Raw data can be found in Supplementary Data 2.

Serum was collected from heart puncture, and glucose, insulin, triglycerides, cholesterol, and ketones were analyzed using VITROS clinical diagnostics.

Mitochondrial DNA quantification

Flash-frozen quadriceps muscle samples of P17 mice were homogenized in Trizol and phase-separated with chloroform. To the interphase and organic phase containing DNA, 4 M guanidine thiocyanate, 50 mM sodium citrate, and 1 M Tris were added; mixed; incubated at room temperature; and centrifuged at 3000 × g at 4 C. The upper phase was transferred to a new tube and DNA was precipitated with isopropanol. DNA pellets were washed 4 times with 75% ethanol, resuspended in 8 mM NaOH, and HEPES and EDTA were added to a final concentration of 10 and 1 mM, respectively. The following primers were used for mtDNA qPCR (MT-MD1) and normalization (LPL):

NADH dehydrogenase subunit 1 (MT-ND1) Forward: 5ʹ-CCCATTCGCGTTATTCTT-3ʹ NADH dehydrogenase subunit 1 Reverse: 5ʹ-AAGTTGATCGTAACGGAAGC-3ʹ

LPL Forward: 5’-GGATGGACGGTAAGAGTGATTC-3’

LPL Reverse: 5’-ATCCAAGGGTAGCAGACAGGT-3’

Proximity biotinylation in C2C12 cells

Proximity biotinylation (BioID) was adapted from prior publications⁵². C2C12 myoblasts expressing pMXs-puro-Net39-miniTurbo were plated on 10 15-cm dishes at 100% confluence and differentiated in DM (DMEM with 2% horse serum and 1% antibiotic–antimycotic; ThermoFisher, 26050088) for 7 days. Five 5-cm dishes were supplemented with 500 µM biotin (Sigma, B4501) for 4 h. The remaining 5 15-cm dishes were used as negative control. Cell lysates were extracted in 1 ml of lysis buffer (6 M urea, 10% SDS, supplemented with cOmplete protease inhibitor cocktail, and PhosSTOP phosphatase inhibitor cocktail) and lysed mechanically with Precellys Evolution (3× 20 s at 6800 rpm). Lysates were added to 9 ml of dilution buffer (50 mM Tris, 150 mM NaCl) and 100 µl of equilibrated streptavidin magnetic beads (ThermoFisher, 88816). Lysates were incubated for 24 h at 4 °C on a wheel. Beads were washed 5 times with lysis buffer and boiled for 10 min in 2× Laemmli sample buffer (Bio-Rad, 1610737). Pulldown was assessed by silver staining (ThermoFisher, LC6070).

For protein identification by MS, samples were run for 1 cm in an Any-KD Mini-PROTEAN 10-well gel (Bio-Rad, # 4569034). Gels were then fixed and stained with EZBlue (Sigma, G1041) as per the provider’s instructions. The area of the gel containing proteins was cut into small 1-mm cubes and submitted for analysis to the Proteomics Core Facility at University of Texas Southwestern Medical Center. Gel band samples were digested overnight with trypsin (Pierce) following reduction and alkylation with DTT and iodoacetamide (Sigma). The samples then underwent solid-phase extraction cleanup with an Oasis HLB plate (Waters), and the resulting samples were injected onto an Orbitrap Fusion Lumos mass spectrometer coupled to an Ultimate 3000 RSLC-Nano liquid chromatography system. Samples were injected onto a 75 µm i.d., 75-cm long EasySpray column (Thermofisher) and eluted with a gradient from 0 to 28% buffer B over 90 min. Buffer A contained 2% (v/v) ACN and 0.1% formic acid in water, and buffer B contained 80% (v/v) ACN, 10% (v/v) trifluoroethanol, and 0.1% formic acid in water. The mass spectrometer operated in positive ion mode with a source voltage of 1.8 kV and an ion transfer tube temperature of 275 °C. MS scans were acquired at 120,000 resolution in the Orbitrap and up to 10 MS/MS spectra were obtained in the ion trap for each full spectrum acquired using higher-energy collisional dissociation for ions with charges 2–7. Dynamic exclusion was set for 25 s after an ion was selected for fragmentation.

Raw MS data files were analyzed using Proteome Discoverer v2.2 (Thermofisher), with peptide identification performed using Sequest HT searching against the mouse protein database from UniProt along with the sequence for Net39-miniTurbo. Fragment and precursor tolerances of 10 ppm and 0.6 Da were specified, and three missed cleavages were allowed. Carbamidomethylation of Cys was set as a fixed modification, with oxidation of Met set as a variable modification. The FDR cutoff was 1% for all peptides. Two independent experiments for BioID were performed. Raw data for Net39 BioID can be found in Supplementary Data 1.

For analysis of enriched hits, results were filtered by enrichment (>20-fold enrichment in “Biotin” samples over “Control” samples) and ordered by abundance. The top 50 highest hits were selected for analysis on STRING and the 5 most enriched GO terms were represented (Supplementary Fig. 5).

Luciferase assays

A region 442-bp upstream of the ORF of Net39 was used for promoter analysis based on MyoD ChIP-seq data on C2C12 differentiation (Supplementary Fig. 1a). Net39 promoter WT or with mutated E-boxes (Mut) were synthesized by Integrated DNA Technologies (IDT) and cloned into the promoterless luciferase reporter pGL4.10[luc2] (Promega, E6651) by conventional cloning. HEK 293T cells were transfected with combinations of reporter and either pCS2-GFP or pcDNA-MyoD-VP16. pcDNA-MyoD-VP16 encodes the bHLH domain of MyoD fused to the activation domain of VP16 and has been previously characterized⁵³. All samples were transfected pCMV-LacZ for normalization of cell numbers. Forty-eight hours after transfection, luciferase assays were performed using Luciferase assay system (Promega, E1500) and beta-galactosidase assays were performed with the Mammalian beta-Galactosidase Assay Kit (Thermofisher, 75707) as per the provider’s instructions. Luminescence and absorbance (405 nm) were read in a CLARIOstar plate reader (BMG Labtech).

DNA primers

A complete list of all primers used is included in Supplementary Data 3.

Transthoracic echocardiography (ECHO)

Cardiac function was determined by two-dimensional ECHO using the Visual Sonics Vevo 2100 Ultrasound (Visual Sonics, Toronto, ON, Canada) on conscious WT and Net39 KO mice at P9 and P17. Fractional shortening (FS) was calculated according to the following formula: FS(%) = [(LVID;d − LVID;s)/LVID;d] × 100. Left ventricular internal diameter (LVID) was measured as the largest anteroposterior diameter in either diastole (LVID;d) or systole (LVID;s). Ejection fraction (EF%) was calculated by: EF(%) = ([EDV − ESV]/EDV) × 100, where EDV is the end diastolic volume and ESV end systolic volume⁵⁴.

Case selection and tissue processing

The use of medical record and human tissues for research purposes was compliant with the ethical principles in the Belmont Report, the Department of Health and Human Service human subject regulations, Title 21 CFR, as well as good clinical practice (as adopted by the Food and Drug Administration), and approved by the UTSW Human Research Protection Program (IRB# STU012016-082). A waiver of patient informed consent was requested and approved by the human research protection program for retrospective study on archived human muscle tissue.

The pathology database at UTSW Medical Center was retrospectively reviewed. Among 10,070 muscle biopsies received between 1980 and 2016, 3 patients genetically confirmed to harbor Lamin A/C mutations and with available frozen muscle tissues were identified. Three normal muscle specimens from age-matched individuals served as controls. Muscle biopsies were collected from alive individuals and stored at −80 °C. Slides and electron microscopic images from all cases were reviewed by an experienced neuropathologist. Human muscle biopsy tissues were collected, processed, and analyzed according to all ethical regulations. Twenty-μm-thick cryosections from each muscle specimen were collected for western blot and quantitative reverse transcriptase PCR (qRT-PCR) analyses. The analysis of human muscle samples was performed by independent researchers. All tissues used in this study were coded and de-identified. Sample information is included in Table 1. RNA was isolated using the RNeasy Micro Kit (Qiagen, 74004) as per the provider’s instructions. cDNA was synthesized using iScript Reverse Transcriptase (Bio-Rad). A Taqman probe (Hs00262043_m1, Thermofisher) was used for qRT-PCR analysis. Protein samples were extracted as described in prior sections.

Statistics

Data are presented as mean ± SEM. For histological and cellular experiments, statistical analysis was performed using one or two-tailed unpaired t tests, as indicated in each figure legend. For genome-wide and metabolomics analysis, a fold change >2 and FDR <0.05 was used. Benjamini and Hochberg procedure was used for multiple hypothesis testing. Sample sizes and p values are indicated in each figure legend.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.